Template DNA is : 3'TACATGGCAAATATCCATTCA5' 5'AUGUACCGUUUAUAGGUAAGU3' m-RNA
NEET UG 2024 — Zoology Molecular Basis of Inheritance
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5
Held on 30 Apr 2024 · Verified 9 Jul 2026.
5'AUGUAAAGUUUAUAGGUAAGU3'
5'AUGUACCGUUUAUAGGGAAGU3'
5'ATGTACCGTTTATAGGTAAGT3'
5'AUGUACCGUUUAUAGGUAAGU3'
Sign in to track your attempts and accuracy.
Sign in to keep a private note on this question. Nothing you write is ever public.
Which factor is important for termination of transcription?
Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exons. C. Addition of methyl group at 5' end of hnRNA. D. Addition of adenine residues at 3 ' end of hnRNA. E. Base pairing of two complementary RNAs. Choose the correct answer from the options given below :
Match List I with List II: $\begin{array}{|l|l|l|l|}\hline & \text{List - I} & & \text{List - II} \\\hline \text{A}. & \text{Alfred Hershey and Martha Chase} & \text{(i)} & \text{Streptococcus pneumoniae} \\\hline \text{B.} & \text{Euchromatin} & \text{(ii)} & \text{Densely packed and dark-stained} \\\hline \text{C.} & \text{Frederick Griffith} & \text{(iii)} & \text{Loosely packed and light-stained} \\\hline \text{D.} & \text{Heterochromatin} & \text{(iv)} & \text{DNA as genetic material confirmation} \\\hline\end{array}$ Choose the correct answer from the options given below:
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
Histones are enriched with -
Work through every NEET UG Molecular Basis of Inheritance PYQ, year by year.