Zoology Molecular Basis of Inheritance questions from NEET UG 2023.
Match List I with List II: <table class="pyq-table"><tbody><tr><td>List I</td><td>List II</td></tr><tr><td>A. Gene 'a'</td><td>I. Beta-galactosidase</td></tr><tr><td>B. Gene 'y'</td><td>II. Transacetylase</td></tr><tr><td>C. Gene 'i'</td><td>III. Permease</td></tr><tr><td>D. Gene 'z'</td><td>IV. Repressor protein</td></tr></tbody></table>Choose the correct answer from the options given below:
Which one of the following acts as an inducer for lac operon?
Given below are two statements: Statement I: RNA being unstable, mutate at a faster rate. Statement II: RNA can directly code for synthesis of proteins, hence can easily express the characters. In the light of the above statements, choose the correct answer from the options given below:
Which of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG '3
Unequivocal proof that DNA is the genetic material was first proposed by
Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:
Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.
The last chromosome sequenced in Human Genome Project was :
Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:
The salient features of genetic code are : (A) The code is palindromic (B) UGA act as initiator codon (C) The code is unambiguous and specific (D) The code is nearly universal Choose the most appropriate answer from the options given below :
Given below are two statements : Statement I: The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. Statement II : A transcription unit in DNA is defined primarily by the three regions in the DNA, i.e., a promotor, the structural gene and a terminator. In the light of the above statements, choose the correct answer from the options given below :
With reference to Hershey and Chase experiments. Select the correct statements. (A) Viruses grown in the presence of radioactive phosphorus contained radioactive DNA. (B) Viruses grown on radioactive sulphur contained radioactive proteins. (C) Viruses grown on radioactive phosphorus contained radioactive protein. (D) Viruses grown on radioactive sulphur contained radioactive DNA. (E) Viruses grown on radioactive protein contained radioactive DNA. Choose the most appropriate answer from the options given below :
Expressed Sequence Tags (ESTs) refers to
Which scientist conducted an experiment with ${ }^{32} \mathrm{P}$ and ${ }^{35} \mathrm{~S}$ labelled phages for demonstrating that DNA is the genetic material?
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?