During transcription, the template strand has an orientation of 3' (promoter side) to 5' (terminator side). The RNA is synthesised in 5'-3' direction by RNA polymerase. The coding strand is complementary to template strand and thus have the same sequence like that of newly formed RNA (except for U, there would be T). Therefore, the coding strand sequence would be
5' ATCGATCGATCGATCGATCGATCGATCG 3'