NEET UG 2024 — Molecular Basis of Inheritance

Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose. Statement II: In addition to lactose, glucose or galactose can also induce lac operon. In the light of the above statements, choose the correct answer from the options given below :

Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have different roles. In the light of the above statements, choose the correct answer from the options given below:

In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:

Match List I with List II: $\begin{array}{|l|l|r|l|}\hline & \text{List I} & & \text{List II} \\ \hline A. & \text{RNA polymerase III} & I. & \text{snRNPs} \\ \hline B. & \begin{array}{l} \text{Termination of} \\ \text{transcription} \end{array} & II. & \text{Promotor} \\ \hline C. & \text{Splicing of Exons} & III. & \text{Rho factor} \\ \hline D. & \text{TATA box} & IV. & \text{SnRNAs, tRNA} \\ \hline \end{array}$ Choose the correct answer from the options given below :

Match List-I with List-II: $\begin{array}{|l|l|r|l|}\hline & \text{List-I} & & \text{List-II} \\ \hline A. & \text{Histones} & I. & \text{Loosely packed chromatin} \\ \hline B. & \text{Nucleosome} & II. & \text{Densely packed Chromatin} \\ \hline C. & \text{Euchromatin} & III. & \text{Positively charged basic proteins} \\ \hline D. & \text{Heterochromatin} & IV. & \begin{array}{l} \text{DNA wrapped around histone} \\ \text{octamer} \end{array} \\ \hline\end{array}$ Choose the correct answer from the options given below:

Match List I with List II  Choose the correct answer from the options given below:

The lactose present in the growth medium of bacteria is transported to the cell by the action of

Which of the following statement is correct regarding the process of replication in E.coli?

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5