Zoology Molecular Basis of Inheritance questions from NEET UG 2024.
Match List-I with List-II: $\begin{array}{|l|l|r|l|}\hline & \text{List-I} & & \text{List-II} \\ \hline A. & \text{Histones} & I. & \text{Loosely packed chromatin} \\ \hline B. & \text{Nucleosome} & II. & \text{Densely packed Chromatin} \\ \hline C. & \text{Euchromatin} & III. & \text{Positively charged basic proteins} \\ \hline D. & \text{Heterochromatin} & IV. & \begin{array}{l} \text{DNA wrapped around histone} \\ \text{octamer} \end{array} \\ \hline\end{array}$ Choose the correct answer from the options given below:
Match List I with List II: $\begin{array}{|l|l|r|l|}\hline & \text{List I} & & \text{List II} \\ \hline A. & \text{RNA polymerase III} & I. & \text{snRNPs} \\ \hline B. & \begin{array}{l} \text{Termination of} \\ \text{transcription} \end{array} & II. & \text{Promotor} \\ \hline C. & \text{Splicing of Exons} & III. & \text{Rho factor} \\ \hline D. & \text{TATA box} & IV. & \text{SnRNAs, tRNA} \\ \hline \end{array}$ Choose the correct answer from the options given below :
Which of the following statement is correct regarding the process of replication in E.coli?
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have different roles. In the light of the above statements, choose the correct answer from the options given below:
In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5
Match List I with List II  Choose the correct answer from the options given below:
Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose. Statement II: In addition to lactose, glucose or galactose can also induce lac operon. In the light of the above statements, choose the correct answer from the options given below :
The lactose present in the growth medium of bacteria is transported to the cell by the action of
Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate transiently with 'Rho' factor to initiate transcription. In the light of the above statements, choose the correct answer from the options given below :