Molecular Basis of Inheritance PYQ

Which factor is important for termination of transcription?

Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exons. C. Addition of methyl group at 5' end of hnRNA. D. Addition of adenine residues at 3 ' end of hnRNA. E. Base pairing of two complementary RNAs. Choose the correct answer from the options given below :

Histones are enriched with -

Which chromosome in the human genome has the highest number of genes?

Given below are two statements : Statement I : In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II: DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. In the light of the above statements, choose the most appropriate answer from the options given below :

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

Match List I with List II: $\begin{array}{|l|l|l|l|}\hline & \text{List - I} & & \text{List - II} \\\hline \text{A}. & \text{Alfred Hershey and Martha Chase} & \text{(i)} & \text{Streptococcus pneumoniae} \\\hline \text{B.} & \text{Euchromatin} & \text{(ii)} & \text{Densely packed and dark-stained} \\\hline \text{C.} & \text{Frederick Griffith} & \text{(iii)} & \text{Loosely packed and light-stained} \\\hline \text{D.} & \text{Heterochromatin} & \text{(iv)} & \text{DNA as genetic material confirmation} \\\hline\end{array}$ Choose the correct answer from the options given below:

Which of the following statement is correct regarding the process of replication in E.coli?

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have different roles. In the light of the above statements, choose the correct answer from the options given below:

In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5

Match List I with List II  Choose the correct answer from the options given below:

Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose. Statement II: In addition to lactose, glucose or galactose can also induce lac operon. In the light of the above statements, choose the correct answer from the options given below :

The lactose present in the growth medium of bacteria is transported to the cell by the action of

Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate transiently with 'Rho' factor to initiate transcription. In the light of the above statements, choose the correct answer from the options given below :

Match List I with List II: $\begin{array}{|l|l|r|l|}\hline & \text{List I} & & \text{List II} \\ \hline A. & \text{RNA polymerase III} & I. & \text{snRNPs} \\ \hline B. & \begin{array}{l} \text{Termination of} \\ \text{transcription} \end{array} & II. & \text{Promotor} \\ \hline C. & \text{Splicing of Exons} & III. & \text{Rho factor} \\ \hline D. & \text{TATA box} & IV. & \text{SnRNAs, tRNA} \\ \hline \end{array}$ Choose the correct answer from the options given below :

Match List-I with List-II: $\begin{array}{|l|l|r|l|}\hline & \text{List-I} & & \text{List-II} \\ \hline A. & \text{Histones} & I. & \text{Loosely packed chromatin} \\ \hline B. & \text{Nucleosome} & II. & \text{Densely packed Chromatin} \\ \hline C. & \text{Euchromatin} & III. & \text{Positively charged basic proteins} \\ \hline D. & \text{Heterochromatin} & IV. & \begin{array}{l} \text{DNA wrapped around histone} \\ \text{octamer} \end{array} \\ \hline\end{array}$ Choose the correct answer from the options given below:

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Which scientist conducted an experiment with ${ }^{32} \mathrm{P}$ and ${ }^{35} \mathrm{~S}$ labelled phages for demonstrating that DNA is the genetic material?

Expressed Sequence Tags (ESTs) refers to

With reference to Hershey and Chase experiments. Select the correct statements. (A) Viruses grown in the presence of radioactive phosphorus contained radioactive DNA. (B) Viruses grown on radioactive sulphur contained radioactive proteins. (C) Viruses grown on radioactive phosphorus contained radioactive protein. (D) Viruses grown on radioactive sulphur contained radioactive DNA. (E) Viruses grown on radioactive protein contained radioactive DNA. Choose the most appropriate answer from the options given below :

Match List I with List II: <table class="pyq-table"><tbody><tr><td>List I</td><td>List II</td></tr><tr><td>A. Gene 'a'</td><td>I. Beta-galactosidase</td></tr><tr><td>B. Gene 'y'</td><td>II. Transacetylase</td></tr><tr><td>C. Gene 'i'</td><td>III. Permease</td></tr><tr><td>D. Gene 'z'</td><td>IV. Repressor protein</td></tr></tbody></table>Choose the correct answer from the options given below:

Which one of the following acts as an inducer for lac operon?